shRNA Lentivirus (self-inactivating), pU6-(Sash3-shRNA-Seq1)(CAT#: LV-SI2246WQ)
This product is a Sash3-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Sash3 gene contains a Src homology-3 (SH3) domain and a sterile alpha motif (SAM), both of which are found in proteins involved in cell signaling. This protein may function as a signaling adapter protein in lymphocytes. The expression of Sash3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Sash3-shRNA-Seq1 |
| Related Target/Protein | Sash3 |
| Region | 3UTR |
| TargetSeq | CCACTATCCTTCTCAACATTT |
| NCBI RefSeq | NM_028773 |
| Alternative Names | SLY; 753P9; HACS2; CXorf9; SH3D6C |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lymphoma |