shRNA Lentivirus (self-inactivating), pU6-(SEC63D1-shRNA-Seq1)(CAT#: LV-SI0368WQ)

This product is a SEC63D1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SEC63D1 gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. The expression of SEC63D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SEC63D1-shRNA-Seq1
Related Target/Protein SEC63D1
Region CDS
TargetSeq GCAAGGGAACTTGAATTGATT
NCBI RefSeq NM_198550
Alternative Names MER3; POF9; Si-11; HFM1; Si-11-6; helicase
Titer >1*10^10 GC/mL
Related Diseases Premature ovarian failure 9 (POF9)
Target Gene
Gene ID 164045
Uniprot ID A2PYH4

Related Products