shRNA Lentivirus (self-inactivating), pU6-(SEC63D1-shRNA-Seq1)(CAT#: LV-SI0368WQ)
This product is a SEC63D1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SEC63D1 gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. The expression of SEC63D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SEC63D1-shRNA-Seq1 |
| Related Target/Protein | SEC63D1 |
| Region | CDS |
| TargetSeq | GCAAGGGAACTTGAATTGATT |
| NCBI RefSeq | NM_198550 |
| Alternative Names | MER3; POF9; Si-11; HFM1; Si-11-6; helicase |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Premature ovarian failure 9 (POF9) |