shRNA Lentivirus (self-inactivating), pU6-(SPACA7-shRNA-Seq2)(CAT#: LV-SI0095WQ)
This product is a SPACA7-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPACA7 gene is involved in fertilization and seems not to play a direct role in sperm-egg binding or gamete fusion. The expression of SPACA7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SPACA7-shRNA-Seq2 |
| Related Target/Protein | SPACA7 |
| Region | CDS |
| TargetSeq | CTGGCAGTGAGAAGAGTGTTT |
| NCBI RefSeq | NM_145248 |
| Alternative Names | C13orf28 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |