shRNA Lentivirus (self-inactivating), pU6-(SPAG17-shRNA-Seq3)(CAT#: LV-SI0223WQ)
This product is a SPAG17-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SPAG17 gene encoded protein is required for the proper function of the axoneme. SPAG17 deficiency results in skeletal malformations and bone abnormalities. The expression of SPAG17-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SPAG17-shRNA-Seq3 |
| Related Target/Protein | SPAG17 |
| Region | CDS |
| TargetSeq | GCACAGTATGAAGAACCGCAA |
| NCBI RefSeq | NM_206996 |
| Alternative Names | PF6; CT143 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Skeletal malformations and bone abnormalities |