shRNA Lentivirus (self-inactivating), pU6-(WDR46-shRNA-Seq3)(CAT#: LV-SI0495WQ)
This product is a WDR46-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The WDR46 gene is required for localization of DDX21 and NCL to the granular compartment of the nucleolus. The expression of WDR46-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | WDR46-shRNA-Seq3 |
Related Target/Protein | WDR46 |
Region | CDS |
TargetSeq | CTTCAGAAACAGGGTTTCTAA |
NCBI RefSeq | NM_005452 |
Alternative Names | UTP7; BING4; FP221; C6orf11 |
Titer | >1*10^10 GC/mL |
Related Diseases | Respiratory Disease |