shRNA Lentivirus (self-inactivating), pU6-(ZER1-shRNA-Seq1)(CAT#: LV-SI1662WQ)
This product is a ZER1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The ZER1 gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The expression of ZER1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | ZER1-shRNA-Seq1 |
| Related Target/Protein | ZER1 |
| Region | CDS |
| TargetSeq | CATAGGAATATGCTAGGACTT |
| NCBI RefSeq | NM_006336 |
| Alternative Names | ZYG; C9orf60; ZYG11BL |
| Titer | >1*10^10 GC/mL |
