shRNA Lentivirus (self-inactivating), pU6-(ZER1-shRNA-Seq1)(CAT#: LV-SI1662WQ)

This product is a ZER1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The ZER1 gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The expression of ZER1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert ZER1-shRNA-Seq1
Related Target/Protein ZER1
Region CDS
TargetSeq CATAGGAATATGCTAGGACTT
NCBI RefSeq NM_006336
Alternative Names ZYG; C9orf60; ZYG11BL
Titer >1*10^10 GC/mL
Target Gene
Gene ID 10444
Uniprot ID Q7Z7L7

Related Products