shRNA Lentivirus (self-inactivating), pU6-(Zpbp-shRNA-Seq2)(CAT#: LV-SI1957WQ)

This product is a Zpbp-shRNA encoding Lentivirus, which is based on HIV-1 serotype. ZPBP is one of several proteins that are thought to participate in secondary binding between acrosome-reacted sperm and the egg-specific extracellular matrix, the zona pellucida. The expression of Zpbp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert Zpbp-shRNA-Seq2
Related Target/Protein Zpbp
Region CDS
TargetSeq GCAACAGTATCTATAACATTT
NCBI RefSeq NM_015785
Alternative Names ZPBP1
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 11055
Uniprot ID Q9BS86

Related Products