shRNA Adeno-associated Virus Serotype 2, p7SK-(Chst15-shRNA-Seq3)(CAT#: AAV-SI3452WQ)
This product is a Chst15-shRNA encoding AAV, which is based on AAV-2 serotype. The Chst15 gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. The expression of Chst15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Chst15-shRNA-Seq3 |
| Related Target/Protein | Chst15 |
| Region | 3UTR |
| TargetSeq | CCCTTAGAATGTCCTCAGAAA |
| NCBI RefSeq | NM_029935 |
| Alternative Names | BRAG; GALNAC4S-6ST |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Thrombus |