shRNA Adeno-associated Virus Serotype 2, p7SK-(Mto1-shRNA-Seq1)(CAT#: AAV-SI4024WQ)
This product is a Mto1-shRNA encoding AAV, which is based on AAV-2 serotype. The Mto1 gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The expression of Mto1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Mto1-shRNA-Seq1 |
| Related Target/Protein | Mto1 |
| Region | CDS |
| TargetSeq | CAAAGTGCTAAACCGGCGTAA |
| NCBI RefSeq | NM_026658 |
| Alternative Names | CGI-02; COXPD10 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Deafness |