shRNA Adeno-associated Virus Serotype 2, p7SK-(OR10A7-shRNA-Seq3)(CAT#: AAV-SI3289WQ)

This product is a OR10A7-shRNA encoding AAV, which is based on AAV-2 serotype. The OR10A7 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR10A7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert OR10A7-shRNA-Seq3
Related Target/Protein OR10A7
Region CDS
TargetSeq CGCACTTCAAACACCCATGTA
NCBI RefSeq XM_062598
Alternative Names OR12-6
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 121364
Uniprot ID Q8NGE5

Related Products