shRNA Adeno-associated Virus Serotype 2, p7SK-(OR5A1-shRNA-Seq2)(CAT#: AAV-SI3325WQ)

This product is a OR5A1-shRNA encoding AAV, which is based on AAV-2 serotype. The OR5A1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR5A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert OR5A1-shRNA-Seq2
Related Target/Protein OR5A1
Region CDS
TargetSeq GCTCCATATTTAGGCTTCACT
NCBI RefSeq XM_166899
Alternative Names OR5A1P; OST181; OR11-249
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 219982
Uniprot ID Q8NGJ0

Related Products