shRNA Adeno-associated Virus Serotype 2, p7SK-(SF3B4-shRNA-Seq4)(CAT#: AAV-SI1044WQ)
This product is a SF3B4-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by SF3B4 gene cross-links to a region in the pre-mRNA immediately upstream of the branchpoint sequence in pre-mRNA in the prespliceosomal complex A. It also may be involved in the assembly of the B, C and E spliceosomal complexes. In addition to RNA-binding activity, this protein interacts directly and highly specifically with subunit 2 of the splicing factor 3B. The expression of SF3B4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SF3B4-shRNA-Seq4 |
Related Target/Protein | SF3B4 |
Region | CDS |
TargetSeq | CGTCCTATCACCGTATCTTAT |
NCBI RefSeq | NM_005850 |
Alternative Names | AFD1; Hsh49; SAP49; SF3b49 |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular carcinoma |