shRNA Adeno-associated Virus Serotype 2, p7SK-(SH3D19-shRNA-Seq2)(CAT#: AAV-SI1279WQ)
This product is a SH3D19-shRNA encoding AAV, which is based on AAV-2 serotype. The SH3D19 gene encoded protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. The expression of SH3D19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SH3D19-shRNA-Seq2 |
| Related Target/Protein | SH3D19 |
| Region | 3UTR |
| TargetSeq | GCCAAATAGGTTGAAGACAAT |
| NCBI RefSeq | NM_001009555 |
| Alternative Names | EBP; EVE1; Kryn; Eve-1; SH3P19 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Acute myeloid leukemia |