shRNA Adeno-associated Virus Serotype 2, p7SK-(SPIRE2-shRNA-Seq2)(CAT#: AAV-SI1264WQ)
This product is a SPIRE2-shRNA encoding AAV, which is based on AAV-2 serotype. The SPIRE2 acts as an actin nucleation factor, remains associated with the slow-growing pointed end of the new filament and is involved in intracellular vesicle transport along actin fibers, providing a novel link between actin cytoskeleton dynamics and intracellular transport. The expression of SPIRE2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SPIRE2-shRNA-Seq2 |
| Related Target/Protein | SPIRE2 |
| Region | 3UTR |
| TargetSeq | CATGATGAAATGTTGTCTCTA |
| NCBI RefSeq | NM_032451 |
| Alternative Names | Spir-2 |
| Titer | >1*10^10 GC/mL |