shRNA Adeno-associated Virus Serotype 2, p7SK-(Tcte1-shRNA-Seq1)(CAT#: AAV-SI3597WQ)
This product is a Tcte1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Tcte1 gene may play a role in the assembly of N-DRC and be required for sperm motility. The expression of Tcte1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Tcte1-shRNA-Seq1 |
| Related Target/Protein | Tcte1 |
| Region | CDS |
| TargetSeq | CCTCACCCACTAACAACTGTA |
| NCBI RefSeq | NM_013688 |
| Alternative Names | DRC5; D6S46; FAP155 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |