shRNA Adeno-associated Virus Serotype 2, p7SK-(THOC1-shRNA-Seq4)(CAT#: AAV-SI1034WQ)

This product is a THOC1-shRNA encoding AAV, which is based on AAV-2 serotype. THOC1, also known as HPR1, is part of the TREX (transcription/export) complex and participate in an apoptotic pathway which is characterized by activation of caspase-6, increases in the expression of BAK1 and BCL2L1 and activation of NF-kappa-B. The expression of THOC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert THOC1-shRNA-Seq4
Related Target/Protein THOC1
Region CDS
TargetSeq GTATGTGCAATGATCTCCTAA
NCBI RefSeq NM_005131
Alternative Names P84; HPR1; P84N5
Titer >1*10^10 GC/mL
Related Diseases Lung cancer, Liver cancer, Breast cancer
Target Gene
Gene ID 9984
Uniprot ID Q96FV9

Related Products