shRNA Adeno-associated Virus Serotype 2, pH1-(C4orf41-shRNA-Seq2)(CAT#: AAV-SI0743WQ)
This product is a C4orf41-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by C4orf41 gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. The expression of C4orf41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C4orf41-shRNA-Seq2 |
| Related Target/Protein | C4orf41 |
| Region | 3UTR |
| TargetSeq | CATGAAAGAATGTCAGACCAT |
| NCBI RefSeq | NM_021942 |
| Alternative Names | GRY; FOIGR; LGMD2S; TRAPPC11; LGMDR18 |
| Titer | >1*10^10 GC/mL |