shRNA Adeno-associated Virus Serotype 2, pH1-(C7orf64-shRNA-Seq4)(CAT#: AAV-SI0827WQ)

This product is a C7orf64-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C7orf64-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C7orf64-shRNA-Seq4
Related Target/Protein C7orf64
Region CDS
TargetSeq GAAGGAATTAGTTGAGCGATT
NCBI RefSeq NM_032120
Alternative Names RBM48; HSPC304
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84060
Uniprot ID Q5RL73

Related Products