shRNA Adeno-associated Virus Serotype 2, pH1-(CASC4-shRNA-Seq3)(CAT#: AAV-SI0619WQ)
This product is a CASC4-shRNA encoding AAV, which is based on AAV-2 serotype. The increased expression level of CASC4 gene is associated with HER-2/neu proto-oncogene overexpression. Amplification and resulting overexpression of this proto-oncogene are found in approximately 30% of human breast and 20% of human ovarian cancers. The expression of CASC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | CASC4-shRNA-Seq3 |
| Related Target/Protein | CASC4 |
| Region | CDS |
| TargetSeq | GCACAAGAAACAGATCGACCA |
| NCBI RefSeq | NM_138423 |
| Alternative Names | H63 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Ovarian cancers, Breast cancer |