shRNA Adeno-associated Virus Serotype 2, pH1-(FAM171A1-shRNA-Seq2)(CAT#: AAV-SI0689WQ)
This product is a FAM171A1-shRNA encoding AAV, which is based on AAV-2 serotype. The FAM171A1 gene is involved in the regulation of the cytoskeletal dynamics and plays a role in actin stress fiber formation. The expression of FAM171A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | FAM171A1-shRNA-Seq2 |
| Related Target/Protein | FAM171A1 |
| Region | CDS |
| TargetSeq | CGGAAGTAATGATGCCAGTTT |
| NCBI RefSeq | NM_001010924 |
| Alternative Names | APCN; C10orf38 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |