shRNA Adeno-associated Virus Serotype 2, pH1-(FAM49B-shRNA-Seq2)(CAT#: AAV-SI0677WQ)
This product is a FAM49B-shRNA encoding AAV, which is based on AAV-2 serotype. FAM49B is a regulator of mitochondrial function and integrity and also inhibits T-cell activation by repressing RAC1 activity and modulating cytoskeleton reorganization. The expression of FAM49B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | FAM49B-shRNA-Seq2 |
Related Target/Protein | FAM49B |
Region | CDS |
TargetSeq | GCAAATCGAATGTCTTTGTTT |
NCBI RefSeq | NM_016623 |
Alternative Names | L1; BM-009 |
Titer | >1*10^10 GC/mL |
Related Diseases | Pancreatic ductal adenocarcinoma (PDAC) |