shRNA Adeno-associated Virus Serotype 2, pH1-(FANCI-shRNA-Seq2)(CAT#: AAV-SI0840WQ)
This product is a FANCI-shRNA encoding AAV, which is based on AAV-2 serotype. The FANCI gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. The expression of FANCI-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | FANCI-shRNA-Seq2 |
| Related Target/Protein | FANCI |
| Region | CDS |
| TargetSeq | CCATTACAATTCTGTCGCCAA |
| NCBI RefSeq | NM_018193 |
| Alternative Names | KIAA1794 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | DNA Damage |