shRNA Adeno-associated Virus Serotype 2, pH1-(JOSD2-shRNA-Seq1)(CAT#: AAV-SI0872WQ)
This product is a JOSD2-shRNA encoding AAV, which is based on AAV-2 serotype. The JOSD2 gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. The expression of JOSD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | JOSD2-shRNA-Seq1 |
| Related Target/Protein | JOSD2 |
| Region | CDS |
| TargetSeq | CACCGGCAACTATGATGTCAA |
| NCBI RefSeq | NM_138334 |
| Alternative Names | SBBI54 |
| Titer | >1*10^10 GC/mL |