shRNA Adeno-associated Virus Serotype 2, pH1-(LSM14B-shRNA-Seq4)(CAT#: AAV-SI0923WQ)
This product is a LSM14B-shRNA encoding AAV, which is based on AAV-2 serotype. The LSM14B gene may play a role in control of mRNA translation. The expression of LSM14B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | LSM14B-shRNA-Seq4 |
Related Target/Protein | LSM14B |
Region | CDS |
TargetSeq | CTTTGATTTCGAGAGTGCAAA |
NCBI RefSeq | NM_144703 |
Alternative Names | FT005; LSM13; FAM61B; RAP55B; C20orf40; bA11M20.3 Expression |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |