shRNA Adeno-associated Virus Serotype 2, pH1-(MICALCL-shRNA-Seq1)(CAT#: AAV-SI0585WQ)
This product is a MICALCL-shRNA encoding AAV, which is based on AAV-2 serotype. The MICALCL gene may cooperate with MAPK1/ERK2 via an intracellular signal transduction pathway in the morphogenetic development of round spermatids to spermatozoa and act as Rab effector protein and play a role in vesicle trafficking. The expression of MICALCL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | MICALCL-shRNA-Seq1 |
Related Target/Protein | MICALCL |
Region | CDS |
TargetSeq | CCAGCTTTCCTTGCAGTTAAA |
NCBI RefSeq | NM_032867 |
Alternative Names | Ebitein1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Renal cancer |