shRNA Adeno-associated Virus Serotype 2, pH1-(Nudcd1-shRNA-Seq2)(CAT#: AAV-SI2700WQ)
This product is a Nudcd1-shRNA encoding AAV, which is based on AAV-2 serotype. The Nudcd1 gene may be a suitable target for antigen-specific immunotherapy. The expression of Nudcd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Nudcd1-shRNA-Seq2 |
| Related Target/Protein | Nudcd1 |
| Region | CDS |
| TargetSeq | CCTAATGGAAATGGTCTAATG |
| NCBI RefSeq | NM_026149 |
| Alternative Names | CML66; OVA66 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Solid tumors |