shRNA Adeno-associated Virus Serotype 2, pH1-(Obfc1-shRNA-Seq1)(CAT#: AAV-SI3200WQ)
This product is a Obfc1-shRNA encoding AAV, which is based on AAV-2 serotype. The Obfc1 gene appears to function in a telomere-associated complex with C17ORF68 and TEN1. The expression of Obfc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Obfc1-shRNA-Seq1 |
| Related Target/Protein | Obfc1 |
| Region | CDS |
| TargetSeq | GCAGCAGAAGATCTACCACAT |
| NCBI RefSeq | NM_175360 |
| Alternative Names | AAF44; OBFC1; AAF-44; RPA-32; bA541N10.2; STN1 |
| Titer | >1*10^10 GC/mL |
