shRNA Adeno-associated Virus Serotype 2, pH1-(Pgm2-shRNA-Seq1)(CAT#: AAV-SI3082WQ)
This product is a Pgm2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Pgm2 gene catalyzes the conversion of the nucleoside breakdown products ribose-1-phosphate and deoxyribose-1-phosphate to the corresponding 5-phosphopentoses and has low glucose 1,6-bisphosphate synthase activity. The expression of Pgm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Pgm2-shRNA-Seq1 |
| Related Target/Protein | Pgm2 |
| Region | CDS |
| TargetSeq | CGGAACTTCTTTACCAGGTAT |
| NCBI RefSeq | NM_028132 |
| Alternative Names | MSTP006 |
| Titer | >1*10^10 GC/mL |
