shRNA Adeno-associated Virus Serotype 2, pH1-(Prb1-shRNA-Seq1)(CAT#: AAV-SI3164WQ)
This product is a Prb1-shRNA encoding AAV, which is based on AAV-2 serotype. The Prb1 gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. The expression of Prb1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Prb1-shRNA-Seq1 |
Related Target/Protein | Prb1 |
Region | CDS |
TargetSeq | CGAAGACTCAAATTCTCAGCT |
NCBI RefSeq | NM_198669 |
Alternative Names | PM; PMF; PMS; PRB1L; PRB1M |
Titer | >1*10^10 GC/mL |