shRNA Adeno-associated Virus Serotype 2, pH1-(PRR14-shRNA-Seq2)(CAT#: AAV-SI0934WQ)
This product is a PRR14-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by PRR14 gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The expression of PRR14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | PRR14-shRNA-Seq2 |
| Related Target/Protein | PRR14 |
| Region | CDS |
| TargetSeq | CTCCTGGAGGAAGAAACAGTA |
| NCBI RefSeq | NM_024031 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung cancer |