shRNA Adeno-associated Virus Serotype 2, pH1-(Pus7-shRNA-Seq4)(CAT#: AAV-SI2636WQ)
This product is a Pus7-shRNA encoding AAV, which is based on AAV-2 serotype. The Pus7 gene encodes pseudouridylate synthase that catalyzes pseudouridylation of RNAs. The expression of Pus7-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Pus7-shRNA-Seq4 |
| Related Target/Protein | Pus7 |
| Region | 3UTR |
| TargetSeq | CAAGTCCTGAGGATCCTAATT |
| NCBI RefSeq | NM_178403 |
| Alternative Names | IDDABS |
| Titer | >1*10^10 GC/mL |