shRNA Adeno-associated Virus Serotype 2, pH1-(Rufy2-shRNA-Seq4)(CAT#: AAV-SI2796WQ)

This product is a Rufy2-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Rufy2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Rufy2-shRNA-Seq4
Related Target/Protein Rufy2
Region 3UTR
TargetSeq CTCATTAGGTCAGCATATAAT
NCBI RefSeq NM_027425
Alternative Names RABIP4R; ZFYVE13
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55680
Uniprot ID Q8WXA3

Related Products