shRNA Adeno-associated Virus Serotype 2, pH1-(SPAM1-shRNA-Seq2)(CAT#: AAV-SI2357WQ)
This product is a SPAM1-shRNA encoding AAV, which is based on AAV-2 serotype. The SPAM1 gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. The expression of SPAM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SPAM1-shRNA-Seq2 |
| Related Target/Protein | SPAM1 |
| Region | CDS |
| TargetSeq | GCAAGGAGTGTGTATAAGGAA |
| NCBI RefSeq | NM_003117 |
| Alternative Names | HYA1; PH20; HYAL1; HYAL3; HYAL5; PH-20; SPAG15; HEL-S-96n |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infertility |