shRNA Adeno-associated Virus Serotype 2, pH1-(TMEM177-shRNA-Seq4)(CAT#: AAV-SI2657WQ)

This product is a TMEM177-shRNA encoding AAV, which is based on AAV-2 serotype. The preotien encoded by TMEM177 gene plays a role in the early steps of cytochrome c oxidase subunit II (MT-CO2/COX2) maturation. The expression of TMEM177-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert TMEM177-shRNA-Seq4
Related Target/Protein TMEM177
Region 3UTR
TargetSeq GTTGGAGCCTTTGGACCTATA
NCBI RefSeq NM_030577
Titer >1*10^10 GC/mL
Target Gene
Gene ID 80775
Uniprot ID Q53S58

Related Products