shRNA Adeno-associated Virus Serotype 2, pU6-(BC027231-shRNA-Seq3)(CAT#: AAV-SI1985WQ)

This product is a BC027231-shRNA encoding AAV, which is based on AAV-2 serotype. The BC027231 gene may play a role in cortex development as part of the Notch signaling pathway. The expression of BC027231-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert BC027231-shRNA-Seq3
Related Target/Protein BC027231
Region CDS
TargetSeq GAAGGCTCATTTCCTTATATG
NCBI RefSeq NM_145972
Alternative Names Nepro
Titer >1*10^10 GC/mL
Related Diseases Neuronal differentiation and embryo development
Target Gene
Gene ID 212547
Uniprot ID Q8R2U2

Related Products