shRNA Adeno-associated Virus Serotype 2, pU6-(BC027231-shRNA-Seq4)(CAT#: AAV-SI1986WQ)
This product is a BC027231-shRNA encoding AAV, which is based on AAV-2 serotype. The BC027231 gene may play a role in cortex development as part of the Notch signaling pathway. The expression of BC027231-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | BC027231-shRNA-Seq4 |
| Related Target/Protein | BC027231 |
| Region | CDS |
| TargetSeq | CAGATGACATTGATGATATTT |
| NCBI RefSeq | NM_145972 |
| Alternative Names | Nepro |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neuronal differentiation and embryo development |