shRNA Adeno-associated Virus Serotype 2, pU6-(C12orf48-shRNA-Seq1)(CAT#: AAV-SI0272WQ)
This product is a C12orf48-shRNA encoding AAV, which is based on AAV-2 serotype. The C12orf48 is required to suppress inappropriate homologous recombination, thereby playing a central role DNA repair and in the maintenance of genomic stability. The expression of C12orf48-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C12orf48-shRNA-Seq1 |
| Related Target/Protein | C12orf48 |
| Region | CDS |
| TargetSeq | CAAACTAGCTAAAGTAGCAAA |
| NCBI RefSeq | NM_017915 |
| Alternative Names | AROM; PARI; PARPBP |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatocellular Carcinoma |
