shRNA Adeno-associated Virus Serotype 2, pU6-(FAM124A-shRNA-Seq2)(CAT#: AAV-SI0286WQ)
This product is a FAM124A-shRNA encoding AAV, which is based on AAV-2 serotype. FAM124A belongs to the FAM124 family. The expression of FAM124A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | FAM124A-shRNA-Seq2 |
Related Target/Protein | FAM124A |
Region | CDS |
TargetSeq | GAAAGCGGACTTCTGCATCTT |
NCBI RefSeq | NM_145019 |
Titer | >1*10^10 GC/mL |
Related Diseases | Mycoplasma pneumoniae pneumonia |