shRNA Adeno-associated Virus Serotype 2, pU6-(HOOK2-shRNA-Seq1)(CAT#: AAV-SI1617WQ)
This product is a HOOK2-shRNA encoding AAV, which is based on AAV-2 serotype. The HOOK2 gene encodes a member of Hook proteins that are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The expression of HOOK2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | HOOK2-shRNA-Seq1 |
| Related Target/Protein | HOOK2 |
| Region | CDS |
| TargetSeq | CCAGAGACGTATGGCAACTTT |
| NCBI RefSeq | NM_013312 |
| Alternative Names | HK2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Obesity and type 2 diabetes |