shRNA Adeno-associated Virus Serotype 2, pU6-(JOSD2-shRNA-Seq2)(CAT#: AAV-SI0372WQ)
This product is a JOSD2-shRNA encoding AAV, which is based on AAV-2 serotype. The JOSD2 gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. The expression of JOSD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | JOSD2-shRNA-Seq2 |
Related Target/Protein | JOSD2 |
Region | CDS |
TargetSeq | GTGTCTACTACAACCTGGACT |
NCBI RefSeq | NM_138334 |
Alternative Names | SBBI54 |
Titer | >1*10^10 GC/mL |