shRNA Adeno-associated Virus Serotype 2, pU6-(KIAA0495-shRNA-Seq2)(CAT#: AAV-SI0426WQ)
This product is a KIAA0495-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of KIAA0495-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | KIAA0495-shRNA-Seq2 |
Related Target/Protein | KIAA0495 |
Region | CDS |
TargetSeq | GCTTTCCAAGTAAAGATACCA |
NCBI RefSeq | NM_207306 |
Alternative Names | PDAM; TP73-AS1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Oligodendroglial tumors |
Target Gene | |
---|---|
Gene ID | 57212 |
Uniprot ID | A0A024R4G0 |