shRNA Adeno-associated Virus Serotype 2, pU6-(PIGW-shRNA-Seq2)(CAT#: AAV-SI0140WQ)

This product is a PIGW-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by PIGW gene is an inositol acyltransferase that acylates the inositol ring of phosphatidylinositol. Defects in this gene are a cause of the age-dependent epileptic encephalopathy West syndrome as well as a syndrome exhibiting hyperphosphatasia and cognitive disability (HPMRS5). The expression of PIGW-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PIGW-shRNA-Seq2
Related Target/Protein PIGW
Region 3UTR
TargetSeq GCAACAGTGTTAACCATATTT
NCBI RefSeq NM_178517
Alternative Names Gwt1; HPMRS5
Titer >1*10^10 GC/mL
Related Diseases Hyperphosphatasia and mental retardation syndrome
Target Gene
Gene ID 284098
Uniprot ID Q7Z7B1

Related Products