shRNA Adeno-associated Virus Serotype 2, pU6-(PIGY-shRNA-Seq3)(CAT#: AAV-SI0069WQ)
This product is a PIGY-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by PIGY gene, which is well-conserved, is encoded by the same bicistronic transcript that encodes phosphatidylinositol glycan anchor biosynthesis, class Y, but the two proteins are unrelated. The expression of PIGY-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | PIGY-shRNA-Seq3 |
| Related Target/Protein | PIGY |
| Region | CDS |
| TargetSeq | CCAATCATTGATGGGATCCCT |
| NCBI RefSeq | NM_032906 |
| Alternative Names | PREY |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hyperphosphatasia and mental retardation syndrome |