shRNA Adeno-associated Virus Serotype 2, pU6-(Prap1-shRNA-Seq1)(CAT#: AAV-SI2291WQ)

This product is a Prap1-shRNA encoding AAV, which is based on AAV-2 serotype. The Prap1 gene may play an important role in maintaining normal growth homeostasis in epithelial cells. The expression of Prap1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Prap1-shRNA-Seq1
Related Target/Protein Prap1
Region CDS
TargetSeq GAAACAGAGAAGGTCTGGGAT
NCBI RefSeq NM_009475
Alternative Names UPA; PRO1195
Titer >1*10^10 GC/mL
Target Gene
Gene ID 118471
Uniprot ID Q96NZ9

Related Products