shRNA Adeno-associated Virus Serotype 2, pU6-(SPAG17-shRNA-Seq2)(CAT#: AAV-SI0222WQ)

This product is a SPAG17-shRNA encoding AAV, which is based on AAV-2 serotype. The SPAG17 gene encoded protein is required for the proper function of the axoneme. SPAG17 deficiency results in skeletal malformations and bone abnormalities. The expression of SPAG17-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SPAG17-shRNA-Seq2
Related Target/Protein SPAG17
Region CDS
TargetSeq CGATAAGTTACTATGGATCAA
NCBI RefSeq NM_206996
Alternative Names PF6; CT143
Titer >1*10^10 GC/mL
Related Diseases Skeletal malformations and bone abnormalities
Target Gene
Gene ID 200162
Uniprot ID Q6Q759

Related Products