shRNA Adeno-associated Virus Serotype 2, pU6-(Tmub1-shRNA-Seq1)(CAT#: AAV-SI2282WQ)

This product is a Tmub1-shRNA encoding AAV, which is based on AAV-2 serotype. The Tmub1 gene encodes a protein that may contribute to the regulation of translation during cell-cycle progression and cell proliferation. The expression of Tmub1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Tmub1-shRNA-Seq1
Related Target/Protein Tmub1
Region 3UTR
TargetSeq CTAGTTTCAAAGAGCTGCCTA
NCBI RefSeq NM_022418
Alternative Names DULP; SB144; C7orf21
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 83590
Uniprot ID Q9BVT8

Related Products