shRNA Adeno-associated Virus Serotype 2, pU6-(TREH-shRNA-Seq1)(CAT#: AAV-SI0369WQ)
This product is a TREH-shRNA encoding AAV, which is based on AAV-2 serotype. The TREH gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. The expression of TREH-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | TREH-shRNA-Seq1 |
| Related Target/Protein | TREH |
| Region | CDS |
| TargetSeq | GAATCGCTATTATGTCCCTTA |
| NCBI RefSeq | NM_007180 |
| Alternative Names | TRE; TREA; TREHD |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Motoneuron degeneration |