shRNA Adeno-associated Virus Serotype 2, pU6-(WDR62-shRNA-Seq3)(CAT#: AAV-SI2101WQ)
This product is a WDR62-shRNA encoding AAV, which is based on AAV-2 serotype. The WDR62 gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and cognitive disability. The expression of WDR62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | WDR62-shRNA-Seq3 |
| Related Target/Protein | WDR62 |
| Region | CDS |
| TargetSeq | CCATCCAAAGATAGCTTGGAT |
| NCBI RefSeq | NM_173636 |
| Alternative Names | MCPH2; C19orf14 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Microencephaly, cortical malformations, and cognitive disability |