shRNA Adeno-associated Virus Serotype 2, pU6-(XKR6-shRNA-Seq4)(CAT#: AAV-SI1999WQ)
This product is a XKR6-shRNA encoding AAV, which is based on AAV-2 serotype. The XKR6 gene may play an important role in cell apoptotic process. The expression of XKR6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | XKR6-shRNA-Seq4 |
| Related Target/Protein | XKR6 |
| Region | CDS |
| TargetSeq | GATCGCAATGATGCTCTTATA |
| NCBI RefSeq | NM_173683 |
| Alternative Names | XRG6; C8orf5; C8orf7; C8orf21 |
| Titer | >1*10^10 GC/mL |