shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Erc1-shRNA-Seq1)(CAT#: AdV-SI4036WQ)
This product is a Erc1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Erc1 gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. The expression of Erc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Erc1-shRNA-Seq1 |
| Related Target/Protein | Erc1 |
| Region | CDS |
| TargetSeq | GCAGATAAAGAACGGACGATT |
| NCBI RefSeq | NM_053204 |
| Alternative Names | ELKS; Cast2; ERC-1; RAB6IP2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Thyroid papillary carcinoma |
