shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Erc1-shRNA-Seq1)(CAT#: AdV-SI4036WQ)

This product is a Erc1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Erc1 gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. The expression of Erc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Erc1-shRNA-Seq1
Related Target/Protein Erc1
Region CDS
TargetSeq GCAGATAAAGAACGGACGATT
NCBI RefSeq NM_053204
Alternative Names ELKS; Cast2; ERC-1; RAB6IP2
Titer >1*10^10 GC/mL
Related Diseases Thyroid papillary carcinoma
Target Gene
Gene ID 23085
Uniprot ID Q8IUD2

Related Products